Skip to main content
Addgene
Open Menu

pKLV2-EF1a-neoT2AFlagCDK10wt-W
(Plasmid #246511)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246511 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pKLV2-EF1a-neoT2AFlagStop-W
  • Backbone manufacturer
    Kosuke Yusa
  • Backbone size w/o insert (bp) 8948
  • Total vector size (bp) 10005
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CDK10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1080
  • Mutation
    Silent mutations are added to make the cDNA resistant to 5 gRNAs
  • Entrez Gene
    CDK10 (a.k.a. ALSAS, PISSLRE)
  • Promoter Human EF1a promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACATAGCGTTGGCTACCCGT
  • 3′ sequencing primer GGGAAGCAATAGCATGATACAAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-EF1a-neoT2AFlagCDK10wt-W was a gift from Kosuke Yusa (Addgene plasmid # 246511 ; http://n2t.net/addgene:246511 ; RRID:Addgene_246511)

  • For your References section:

    CDK10 loss primes tumor cells for transcriptional vulnerability and sensitizes to CDK12/13 inhibition. Islam S, Tarumoto Y, Takano M, Sugino S, Nishibuchi G, Mizutani A, Yamakawa H, Morishita D, Yusa K. Cell Death Dis. 2026 Jun 11;17(1):737. doi: 10.1038/s41419-026-08973-x. 10.1038/s41419-026-08973-x PubMed 42270604
Related items: