-
Depositing Lab
-
Depositing OrganizationUniversity of California, Los Angeles (UCLA)
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 24794-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 24794-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3950
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLck-GCaMP2
-
Alt nameGCaMP
-
Alt nameGCaMP2
-
Alt nameLck-GCaMP
-
Insert Size (bp)1480
-
MutationPlasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP2. 6xHis and Xpress (FLAG-like) epitope tags contained within 'RSET' sequence, making up the linker region between Lck and GCaMP2
-
Tags
/ Fusion Proteins
- His
- Xpress
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAGAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA. Sagasti (UCLA) for the GCaMP2 plasmid and D.E. Bergles (Johns Hopkins) for the Lck domain containing plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 24794-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 24794-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN1-Lck-GCaMP2 was a gift from Baljit Khakh (Addgene plasmid # 24794 ; http://n2t.net/addgene:24794 ; RRID:Addgene_24794) -
For your References section:
A genetically targeted optical sensor to monitor calcium signals in astrocyte processes. Shigetomi E, Kracun S, Sofroniew MV, Khakh BS.. Nat Neurosci. 2010 Jun;13(6):759-66. 10.1038/nn.2557 PubMed 20495558