pRL038
(Plasmid
#250169)
-
PurposeDGRec 2 plasmid-system: encodes bRT, avd, and a dgrRNA cloning site (containing ccdB toxin, to replace with TR). Allows dual targeting in combination with pRL021.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRL038
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsPlasmid to propagate in a ccdB survival strain. Upon cloning a TR with BsaI, transform into regular DH5alpha to counterselect the parent plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebRT
-
SpeciesBordetella phage BPP-1
-
Entrez Genebrt (a.k.a. bbp5)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATCGTAAAGAACATTTTGAGGCAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.24.644984 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRL038 was a gift from David Bikard (Addgene plasmid # 250169 ; http://n2t.net/addgene:250169 ; RRID:Addgene_250169) -
For your References section:
Diversity-generating retroelements for programmable targeted hypermutagenesis. Rochette P, Lopez-Rodriguez E, Wen DJ, Regnier L, Fan C, Maikova A, Rostain W, Wang L, Nooraddin I, Maire A, Vittot P, Barrabes N, Cerdas-Mejias KM, Bouvier A, Chrysostomou T, Subrini O, Wolff N, Monasson R, Cocco S, Shipman SL, Laurenceau R, Bikard D. Nat Biotechnol. 2026 Apr 16. doi: 10.1038/s41587-026-03078-4. 10.1038/s41587-026-03078-4 PubMed 41992038