Skip to main content

lentiGuide-Puro-PJY390
(Plasmid #251159)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251159 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    lentiGuide-puro
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #52963
  • Total vector size (bp) 10193
  • Modifications to backbone
    Replaced SpCas9 sgRNA scaffold to F+E version for compatibility with 10x FLEX
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9 sgRNA F+E
  • gRNA/shRNA sequence
    NA
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hU6-F (GACTATCATATGCTTACCGT)
  • 3′ sequencing primer ATTGTGGATGAATACTGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuide-Puro-PJY390 was a gift from Alexander Marson (Addgene plasmid # 251159 ; http://n2t.net/addgene:251159 ; RRID:Addgene_251159)
  • For your References section:

    Genome-scale perturb-seq in primary human CD4+ T cells maps context-specific regulators of T cell programs and human immune traits. Zhu R, Dann E, Yan J, Retana JR, Goto R, Guitche RC, Petersen LK, Ota M, Pritchard JK, Marson A. bioRxiv 2025.12.23.696273 10.64898/2025.12.23.696273