CROPseq-Puro-P2A-EGFP-PJY463
(Plasmid
#254300)
-
PurposeCloning backbone for guide RNAs compatible with 10x FLEX and CROPseq
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254300 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiGuide-puro
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52963
- Total vector size (bp) 10067
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSFFV-Puro-P2A-EGFP-WPRE-hU6-sgRNA
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGGCACTGACAATTCCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-Puro-P2A-EGFP-PJY463 was a gift from Alexander Marson (Addgene plasmid # 254300 ; http://n2t.net/addgene:254300 ; RRID:Addgene_254300)