pGA-01-47
(Plasmid
#252303)
-
PurposeMagLOV2 for constitutive expression in E. Coli
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTU1
- Backbone size w/o insert (bp) 2314
- Total vector size (bp) 2701
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMagLOV 2
-
SpeciesSynthetic
-
Insert Size (bp)477
- Promoter J23119
-
Tag
/ Fusion Protein
- 6xHis-tag
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer gaattcgcggccgcttctag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGA-01-47 was a gift from Harrison Steel (Addgene plasmid # 252303 ; http://n2t.net/addgene:252303 ; RRID:Addgene_252303) -
For your References section:
Quantum spin resonance in engineered proteins for multimodal sensing. Abrahams G, Stuhec A, Spreng V, Henry R, Kempf I, James J, Sechkar K, Stacey S, Trelles-Fernandez V, Antill LM, Timmel CR, Miller JJ, Ingaramo M, York AG, Tetienne JP, Steel H. Nature. 2026 Jan 21. doi: 10.1038/s41586-025-09971-3. 10.1038/s41586-025-09971-3 PubMed 41565820