pET28b-hnRNPK-FL
(Plasmid #252528)

• Purpose: Expresses full-length human hnRNPK
• Depositing Lab: Deborah Wuttke
• Publication: Nakamoto et al Nucleic Acids Res. 2020 Sep 18;48(16):9320-9335. doi: 10.1093/nar/gkaa677.

Backbone

• Vector backbone: pET28b
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 7300
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use Rosetta3 strain for protein expression
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hnRNPK
• Alt name: Heterogeneous nuclear ribonuclear protein K
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 1389
• Entrez Gene: HNRNPK (a.k.a. AUKS, CSBP, HNRPK, TUNP)
• Promoter: Lac
• Tag / Fusion Protein:
  • 10x-His-SUMO (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tcatgtctgtataccgtcgacctctagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Human/mouse hnRNPK cDNA was obtained from Addgene in a pcDNA3.1 vector.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mouse and human hnRNPK are 100% identical.

Primers were used to PCR amplify cDNA insert for ligation into a pET28b vector containing an N-terminal 10xHis-SUMO tag using the Quick Ligation kit (NEB).