Skip to main content
Addgene
Open Menu

pREW2[luciferase fragment in pPD129.36/L4440]
(Plasmid #253297)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253297 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pPD129.36
  • Backbone manufacturer
    Andy Fire
  • Backbone size w/o insert (bp) 4346
  • Total vector size (bp) 4639
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    luciferase fragment
  • Insert Size (bp)
    293
  • Promoter Twin T7 promoters

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AAGCTT (not destroyed)
  • 3′ cloning site CTCGAG (not destroyed)
  • 5′ sequencing primer CGAGTCAGTGAGCGAGGAAGC
  • 3′ sequencing primer GTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Must be used in strain HT115 or equivalent strain optimized for bacterially mediated RNAi in C. elegans.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pREW2[luciferase fragment in pPD129.36/L4440] was a gift from David Reiner (Addgene plasmid # 253297 ; http://n2t.net/addgene:253297 ; RRID:Addgene_253297)

  • For your References section:

    Ral Signals through a MAP4 Kinase-p38 MAP Kinase Cascade in C. elegans Cell Fate Patterning. Shin H, Kaplan REW, Duong T, Fakieh R, Reiner DJ. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. 10.1016/j.celrep.2018.08.011 PubMed 30184501
Related items: