pSpCas9 UGT1+LP400~3p (pNCH0155)
(Plasmid
#254042)
-
PurposeExpress SpCas9 and two gRNAs: UGT1 and LP400~3p
-
Depositing Lab
-
Depositing OrganizationNYU Grossman School of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 9000
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUGT1 + LP400~3p
-
gRNA/shRNA sequenceGCTTCATGTGGTCGGGGTAG and GAAGTTATGAACGCGCCTGC
-
SpeciesSynthetic
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid express two gRNAs, each driven by a human U6 promoter and a CAG promoter-driven SpCas9-NLS.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9 UGT1+LP400~3p (pNCH0155) was a gift from Jef Boeke (Addgene plasmid # 254042 ; http://n2t.net/addgene:254042 ; RRID:Addgene_254042) -
For your References section:
Improved vector toolkit for genome writing in mammalian cells. Barriball K, Berrios B, Coelho C, Pinglay S, Zhao Y, Chalhoub N, Tsou T, Atwater JT, Boeke JD, Zhang W, Brosh R. bioRxiv [Preprint]. 2026 Mar 17:2026.03.15.711894. doi: 10.64898/2026.03.15.711894. 10.64898/2026.03.15.711894 PubMed 41890105