His6-V5-RNaseR
(Plasmid #254214)

• Purpose: His6-V5-RNaseR encodes full-size RNAse R. It specifically degrades linear RNAs with free 3' end. It has both an N-terminal 6x HIS tag and a V5 tag ahead of a TEV cleavage site
• Depositing Lab: Daniel Kiss
• Depositing Organization: Houston Methodist
  Located in the United States of America
• Publication: Purification of Recombinant RNase R (unpublished)

Backbone

• Vector backbone: pUD1074
• Backbone size w/o insert (bp): 5658
• Total vector size (bp): 8199
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: His6-V5-RNaseR full Length
• Species: E. coli
• Insert Size (bp): 2019
• Mutation: Deletion 1-86, deletion 726-813
• GenBank ID: WP_180246742 WP_180246742
• Promoter: t7
• Tags / Fusion Proteins:
  • HIS6 (N terminal on insert)
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: none (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry