Skip to main content
Addgene
Open Menu

pLenti Neo glnA PCC 6803 5x sites native GFP
(Plasmid #254307)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254307 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pLenti PGK Neo DEST (w531-1)
  • Vector type
    Mammalian Expression, Lentiviral, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX: agctcgtttagtgaaccgtcagatc
  • 3′ sequencing primer WPRE-R: catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.04.06.647450 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti Neo glnA PCC 6803 5x sites native GFP was a gift from Samuel McBrayer (Addgene plasmid # 254307 ; http://n2t.net/addgene:254307 ; RRID:Addgene_254307)

  • For your References section:

    A transcriptional biosensor reveals mechanisms of alpha-ketoglutarate signaling to chromatin. Sternisha AC, Li H, Gajendra K, Xiao Y, Zhao X, Traylor JI, Guo L, Jun JH, Fleishman M, Shipman T, Puliyappadamba VT, Kaphle P, Ouyang Q, Schmidt M, Shi DD, Savani MR, Tsai AC, Lee JH, Gordillo R, Garcia-Bermudez J, Kim YJ, Tso SC, Brautigam CA, Zacharias LG, Mathews TP, Xu L, Doench JG, Koduri V, Abdullah KG, Agathocleous M, Banaszynski LA, DeBerardinis RJ, Morrow EM, McBrayer SK. Science. 2026 Jul 16;393(6808):eadx8675. doi: 10.1126/science.adx8675. Epub 2026 Jul 16. 10.1126/science.adx8675 PubMed 42462028
Related items: