Skip to main content

pLenti EF1a VP64-NtcA-2xNLS_SV40
(Plasmid #254308)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254308 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti EF1a PGK Hygro DEST
  • Vector type
    Mammalian Expression, Lentiviral, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VP64-NtcA-2xNLS_SV40
  • Insert Size (bp)
    890
  • Mutation
    NtcA R90E
  • Promoter EF1a
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer EF1a-F: tcaagcctcagacagtggttc
  • 3′ sequencing primer MSCV-R: cagcggggctgctaaagcgcatgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.04.06.647450 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti EF1a VP64-NtcA-2xNLS_SV40 was a gift from Samuel McBrayer (Addgene plasmid # 254308 ; http://n2t.net/addgene:254308 ; RRID:Addgene_254308)
  • For your References section:

    A transcriptional biosensor reveals mechanisms of alpha-ketoglutarate signaling to chromatin. Sternisha AC, Li H, Gajendra K, Xiao Y, Zhao X, Traylor JI, Guo L, Jun JH, Fleishman M, Shipman T, Puliyappadamba VT, Kaphle P, Ouyang Q, Schmidt M, Shi DD, Savani MR, Tsai AC, Lee JH, Gordillo R, Garcia-Bermudez J, Kim YJ, Tso SC, Brautigam CA, Zacharias LG, Mathews TP, Xu L, Doench JG, Koduri V, Abdullah KG, Agathocleous M, Banaszynski LA, DeBerardinis RJ, Morrow EM, McBrayer SK. Science. 2026 Jul 16;393(6808):eadx8675. doi: 10.1126/science.adx8675. Epub 2026 Jul 16. 10.1126/science.adx8675 PubMed 42462028