pLenti EF1a VP64-NtcA_R90E-2xNLS_SV40
(Plasmid
#254309)
-
PurposeConstitutive expression of VP64- NtcA_R90E-2xNLS_SV40 for use in the inactive aKG-ON biosensor. Requires pLenti Neo glnA PCC 6803 reporter gene plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti EF1a PGK Hygro DEST
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVP64-NtcA_R90E-2xNLS_SV40
-
Insert Size (bp)890
-
MutationNtcA R90E
- Promoter EF1a
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EF1a-F: tcaagcctcagacagtggttc
- 3′ sequencing primer MSCV-R: cagcggggctgctaaagcgcatgc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.04.06.647450 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti EF1a VP64-NtcA_R90E-2xNLS_SV40 was a gift from Samuel McBrayer (Addgene plasmid # 254309 ; http://n2t.net/addgene:254309 ; RRID:Addgene_254309) -
For your References section:
A transcriptional biosensor reveals mechanisms of alpha-ketoglutarate signaling to chromatin. Sternisha AC, Li H, Gajendra K, Xiao Y, Zhao X, Traylor JI, Guo L, Jun JH, Fleishman M, Shipman T, Puliyappadamba VT, Kaphle P, Ouyang Q, Schmidt M, Shi DD, Savani MR, Tsai AC, Lee JH, Gordillo R, Garcia-Bermudez J, Kim YJ, Tso SC, Brautigam CA, Zacharias LG, Mathews TP, Xu L, Doench JG, Koduri V, Abdullah KG, Agathocleous M, Banaszynski LA, DeBerardinis RJ, Morrow EM, McBrayer SK. Science. 2026 Jul 16;393(6808):eadx8675. doi: 10.1126/science.adx8675. Epub 2026 Jul 16. 10.1126/science.adx8675 PubMed 42462028