pcDNA3.1-Gαi1ΔF-Gβ1-Gγ2
(Plasmid #254721)

• Purpose: Expresses G protein heterotrimer with Gαi1-ΔF, Gβ1 and Gγ2-GFP2 fusion as negative control. Vector used as controlfor G protein recruitment or 'nuc-BRET' assay. Based on TRUPATH Triple Gαi1 (#196048).
• Depositing Lab: Cornelius Gati
• Publication: Khan et al Nature. 2025 Dec;648(8094):755-763. doi: 10.1038/s41586-025-09677-6. Epub 2025 Nov 5.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): -8
• Total vector size (bp): 7824
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Gαi1
• Alt name: GNAI1
• Species: H. sapiens (human)
• Insert Size (bp): -6
• Mutation: deleted C-terminal amino acid F264
• Entrez Gene: GNAI1 (a.k.a. Gi, HG1B, NEDHISB)
• Promoter: IRES

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCAGAGGAAGTCTTCTAACATGCGGTGAC

Gene/Insert 2

• Gene/Insert name: Gβ1
• Alt name: GNB1
• Species: H. sapiens (human)
• Entrez Gene: GNB1 (a.k.a. HG2A, MDS, MRD42)
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGC AAA TGG GCG GTA GGC GTG

Gene/Insert 3

• Gene/Insert name: Gγ2
• Alt name: GNG2
• Species: H. sapiens (human)
• Entrez Gene: GNG2 (a.k.a. HG3F1)
• Promoter: T2A
• Tag / Fusion Protein:
  • GFP2 (N terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtctaggccccccgaaccacg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry