pMA-RQ-PNPLA3-I148M
(Plasmid
#255037)
-
PurposeContains a portion of the PNPLA3 gene to allow introduction of the I148M encoding allele by gene editing
-
Depositing Lab
-
Depositing OrganizationMedical University of South Carolina
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMA-RQ (AmpR)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePatatin-like Phospholipase domain-containing 3 (PNPLA3)
-
SpeciesH. sapiens (human)
-
MutationMutated isoleucine 148 to methionine (I148M); recapitulates the PNPLA3 I148M-mediated onset of lipid accumulation
-
Entrez GenePNPLA3 (a.k.a. ADPN, C22orf20, iPLA(2)epsilon)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (unknown if destroyed)
- 3′ cloning site SfiI (unknown if destroyed)
- 5′ sequencing primer GCCCTGCTCACTTGGAGAAA
- 3′ sequencing primer ATATGATGTTGGCCAGGCGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA-RQ-PNPLA3-I148M was a gift from Stephen Duncan (Addgene plasmid # 255037 ; http://n2t.net/addgene:255037 ; RRID:Addgene_255037) -
For your References section:
A PNPLA3-Deficient iPSC-Derived Hepatocyte Screen Identifies Pathways to Potentially Reduce Steatosis in Metabolic Dysfunction-Associated Fatty Liver Disease. Doueiry C, Kappler CS, Martinez-Morant C, Duncan SA. Int J Mol Sci. 2024 Jul 2;25(13):7277. doi: 10.3390/ijms25137277. 10.3390/ijms25137277 PubMed 39000384