Skip to main content
Addgene
Open Menu

pMA-RQ-PNPLA3-I148M
(Plasmid #255037)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 255037 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pMA-RQ (AmpR)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Patatin-like Phospholipase domain-containing 3 (PNPLA3)
  • Species
    H. sapiens (human)
  • Mutation
    Mutated isoleucine 148 to methionine (I148M); recapitulates the PNPLA3 I148M-mediated onset of lipid accumulation
  • Entrez Gene
    PNPLA3 (a.k.a. ADPN, C22orf20, iPLA(2)epsilon)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (unknown if destroyed)
  • 3′ cloning site SfiI (unknown if destroyed)
  • 5′ sequencing primer GCCCTGCTCACTTGGAGAAA
  • 3′ sequencing primer ATATGATGTTGGCCAGGCGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA-RQ-PNPLA3-I148M was a gift from Stephen Duncan (Addgene plasmid # 255037 ; http://n2t.net/addgene:255037 ; RRID:Addgene_255037)

  • For your References section:

    A PNPLA3-Deficient iPSC-Derived Hepatocyte Screen Identifies Pathways to Potentially Reduce Steatosis in Metabolic Dysfunction-Associated Fatty Liver Disease. Doueiry C, Kappler CS, Martinez-Morant C, Duncan SA. Int J Mol Sci. 2024 Jul 2;25(13):7277. doi: 10.3390/ijms25137277. 10.3390/ijms25137277 PubMed 39000384
Related items: