pHDE_PR1::RUBY
(Plasmid
#255430)
-
PurposePathogen-inducible PR1 promoter driving the non-invasive RUBY reporter gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHDE-RUBY
-
Backbone manufacturerZhao lab at UCSD
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePR1 promoter from Arabidopsis thaliana Col-0
-
SpeciesA. thaliana (mustard weed)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer cctgtcaaacactgatagtttaaactag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's NGS result has discrepancies compared to the depositor's reference sequence: 2bp indel and 1bp indel in PR1 promoter, both in homopolymer regions. The depositor confirms this is not of concern for plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHDE_PR1::RUBY was a gift from Bastiaan Bargmann (Addgene plasmid # 255430 ; http://n2t.net/addgene:255430 ; RRID:Addgene_255430) -
For your References section:
A Non-Invasive Pathogen‑Responsive RUBY Reporter Enables Visible Monitoring of PR1 Activation. McMullan LO, Taylor JS, Hanlon R, Harris AT, Shuman JL, Schmale III DG, and Bargmann BOR. MicroPubl Biol. (2026). doi: 10.17912/micropub.biology.002174. 10.17912/micropub.biology.002174