Skip to main content

pHDE_PR1::RUBY
(Plasmid #255430)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 255430 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pHDE-RUBY
  • Backbone manufacturer
    Zhao lab at UCSD
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PR1 promoter from Arabidopsis thaliana Col-0
  • Species
    A. thaliana (mustard weed)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer cctgtcaaacactgatagtttaaactag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's NGS result has discrepancies compared to the depositor's reference sequence: 2bp indel and 1bp indel in PR1 promoter, both in homopolymer regions. The depositor confirms this is not of concern for plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHDE_PR1::RUBY was a gift from Bastiaan Bargmann (Addgene plasmid # 255430 ; http://n2t.net/addgene:255430 ; RRID:Addgene_255430)
  • For your References section:

    A Non-Invasive Pathogen‑Responsive RUBY Reporter Enables Visible Monitoring of PR1 Activation. McMullan LO, Taylor JS, Hanlon R, Harris AT, Shuman JL, Schmale III DG, and Bargmann BOR. MicroPubl Biol. (2026). doi: 10.17912/micropub.biology.002174. 10.17912/micropub.biology.002174