AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-mCherry-KASH-WPRE-PA-ITR
(Plasmid #259718)

• Purpose: Expresses sgRNA under U6 promoter and Cre recominase under hSyn promoter with mCherry-KASH nuclear envelope reporter and contains SapI cut sites for sgRNA cloning
• Depositing Lab: Shawn Liu
• Depositing Organization: Columbia University
  Located in the United States of America
• Publication: Pan et al Nat Commun. 2025 Dec 10;17(1):527. doi: 10.1038/s41467-025-67222-5.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2879
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA
• Insert Size (bp): 100
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Golden Gate
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTC

Gene/Insert 2

• Gene/Insert name: Cre
• Insert Size (bp): 1047
• Promoter: hSyn

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: tgtcgtgcctgagagcgcag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry