Skip to main content
Addgene
Open Menu

pAAV-hSyn1-EGFP-Sensor (vgat)-tTA2-WPRE
(Plasmid #259778)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259778 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    hSyn1-EGFP-Sensor (tdT)-tTA2-WPRE
  • Total vector size (bp) 6471
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RNA sensor for mouse vgat
  • Species
    M. musculus (mouse)
  • Promoter hSyn1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CGGCATGGACGAGCTGTACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sensor sequence targeting mouse vgat is cloned from pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE (Plasmid #239030).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn1-EGFP-Sensor (vgat)-tTA2-WPRE was a gift from Jerzy Szablowski (Addgene plasmid # 259778 ; http://n2t.net/addgene:259778 ; RRID:Addgene_259778)

  • For your References section:

    Monitoring in vivo transcription with synthetic serum markers. Watanabe S, Lee S, Harb M, Nouraein S, Raisley E, Li H, Buitrago N, Pforr B, Szablowski JO. Nat Commun. 2026 May 27. doi: 10.1038/s41467-026-73486-2. 10.1038/s41467-026-73486-2 PubMed 42203776
Related items: