pPB-TRE3G-KRAB-dCas9-EGFP-HygR
(Plasmid
#261262)
-
PurposePiggyBac vector to stably integrate doxycycline inducible KRAB(Zim3)-dCas9
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 261262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 261262-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 261262-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPB-TRE3G
- Backbone size w/o insert (bp) 8036
- Total vector size (bp) 13449
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersHygromycin ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAB-dCas9
-
Alt nameZim3-dCas9
-
SpeciesSynthetic; Streptococcus pyogenes Cas9
-
Insert Size (bp)5403
-
MutationD10A and H840A
- Promoter TRE3G
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- P2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer accctcgtaaaggtctagag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In the original publication, CROPseq-Guide-Puro (Christoph Bock, Addgene Plasmid #86708) was used for sgRNA expression.
DNA (Catalog # 261262-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 261262-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-TRE3G-KRAB-dCas9-EGFP-HygR was a gift from Prashant Mali (Addgene plasmid # 261262 ; http://n2t.net/addgene:261262 ; RRID:Addgene_261262) -
For your References section:
A genome-scale CRISPRi perturbation atlas of human induced pluripotent stem cells. Nourreddine S, Doctor Y, Dailamy A, Lee YH, Hansen JN, Chinn R, Forget A, Polacco B, Muralidharan M, Sigaeva A, Sunder S, Pan E, Gao J, Chen JY, Clark T, Parker J, Obernier K, Metallo C, Ideker T, Lundberg E, Krogan N, Mali P. Nat Biotechnol. 2026 Jul 1. doi: 10.1038/s41587-026-03199-w. 10.1038/s41587-026-03199-w PubMed 42386990
Map uploaded by the depositor.
