pPB-TRE3G-KRAB-dCas9-EGFP-HygR
(Plasmid #261262)

• Purpose: PiggyBac vector to stably integrate doxycycline inducible KRAB(Zim3)-dCas9
• Depositing Lab: Prashant Mali
• Depositing Organization: University of California, San Diego (UCSD)
  Located in the United States of America
• Publication: Nourreddine et al Nat Biotechnol. 2026 Jul 1. doi: 10.1038/s41587-026-03199-w.

Backbone

• Vector backbone: pPB-TRE3G
• Backbone size w/o insert (bp): 8036
• Total vector size (bp): 13449
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Hygromycin ; EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAB-dCas9
• Alt name: Zim3-dCas9
• Species: Synthetic; Streptococcus pyogenes Cas9
• Insert Size (bp): 5403
• Mutation: D10A and H840A
• Promoter: TRE3G
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • P2A-EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: accctcgtaaaggtctagag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

In the original publication, CROPseq-Guide-Puro (Christoph Bock, Addgene Plasmid #86708) was used for sgRNA expression.