pET30a(+)-RF3-C-mKate2
(Plasmid #261408)

• Purpose: Expresses RF3 with C-terminal mKate2 (+ HisTag in E. coli), kanamycin 50 µg/ml
• Depositing Lab: Andrei Lupas
• Depositing Organization: Max Planck Institute for Biology
  Located in Germany
• Publication: FluoroPURE Plasmids (unpublished)

Backbone

• Vector backbone: pET30a(+)
• Backbone manufacturer: Alexandra Waldherr (Max Planck), BioCat (Heidelberg, Germany)
• Backbone size w/o insert (bp): 5225
• Total vector size (bp): 7559
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: expresses well in BL21(DE3) (0.1-1 mM IPTG) O/N 18°C to 4 h 37°C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RF3
• Alt name: Release factor 3
• Alt name: prfC
• Insert Size (bp): 2334
• Entrez Gene: prfC (a.k.a. b4375, ECK4366, miaD, tos)
• Promoter: T7
• Tag / Fusion Protein:
  • Fluorescent protein (FP) and HIS-tag: C-terminal ...TEV-FP-His construct (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: GAAATTAATACGACTCACTATAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid construct cannot be used for commercial purposes. Academic use has to please credit Alexandra Waldherr :)

Benchling link to our map: https://benchling.com/s/seq-vOqa5MtbTHjN7nv4VfPT?item_id=seq_ZqquJrc8oY&m=slm-zvMWiSQ0R5QJhIXjEHcg