pET30a(+)-CK-C-SuperfolderBFP
(Plasmid #261420)

• Purpose: Expresses CK with C-terminal SuperfolderBFP (+ HisTag in E. coli), kanamycin 50 µg/ml, CK = creatine kinase (required for ATP and GTP regeneration, removes -P from creatine phosphate)
• Depositing Lab: Andrei Lupas
• Depositing Organization: Max Planck Institute for Biology
  Located in Germany
• Publication: FluoroPURE Plasmids (unpublished)

Backbone

• Vector backbone: pET30a(+)
• Backbone manufacturer: Alexandra Waldherr (Max Planck), BioCat (Heidelberg, Germany)
• Backbone size w/o insert (bp): 5225
• Total vector size (bp): 7133
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: expresses well in BL21(DE3) (0.1-1 mM IPTG) O/N 18°C to 4 h 37°C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CK
• Alt name: Creatine kinase
• Alt name: CKM
• Insert Size (bp): 1908
• Entrez Gene: CKM (a.k.a. CPK-M)
• Promoter: T7
• Tag / Fusion Protein:
  • Fluorescent protein (FP) and HIS-tag: C-terminal ...TEV-FP-His construct (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: GAAATTAATACGACTCACTATAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid construct cannot be used for commercial purposes. Academic use please credit Alexandra Waldherr :)

Benchling link to our map: https://benchling.com/s/seq-ooHFTpihYorU6fJVI4g4?item_id=seq_FvaKfkquGP&m=slm-PJKR7xdpw1JM2vRPMe0R