pAAVS1-CAG-KRAB-dCas9-P2A-EGFP-BSD
(Plasmid #262517)

• Purpose: CRISPRi cassette KRAB(Zim3)-dCas9 into the PPP1R12C locus AAVS1 safe-harbor locus.
• Depositing Lab: Prashant Mali
• Depositing Organization: University of California, San Diego (UCSD)
  Located in the United States of America
• Publication: Nourreddine et al Nat Biotechnol. 2026 Jul 1. doi: 10.1038/s41587-026-03199-w.

Backbone

• Vector backbone: pBluescript-II
• Total vector size (bp): 14282
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Blasticidin ; EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAB-dCas9-P2A-EGFP
• Alt name: Zim3-dCas9-P2A-EGFP
• Species: Synthetic
• Insert Size (bp): 5891
• Promoter: CAG
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tttttcctacagctcctggg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AAVS1 safe-harbor targeting donor for constitutive expression of a ZIM3-KRAB–dCas9–P2A-EGFP CRISPRi fusion. The CAG promoter drives the N-terminal ZIM3 KRAB repressor domain fused to catalytically-dead Cas9 (D10A, H840A) with a C-terminal HA tag, SV40 NLS, P2A self-cleaving peptide, and EGFP reporter. A promoter-trap SA-BSD cassette enables blasticidin selection of correctly targeted clones. HA-L (804 bp) and HA-R (837 bp) homology arms target the PPP1R12C (AAVS1) locus.

In the original publication, CROPseq-Guide-Puro (Christoph Bock, Addgene Plasmid #86708) was used for sgRNA expression.