Skip to main content
Addgene
Open Menu

pAAVS1-BxB1-LP-mCherry-BSD
(Plasmid #262518)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 262518 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 262518-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 262518-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pBluescript-II
  • Total vector size (bp) 9639
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin ; mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    708
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gaattaaccctcactaaagg
  • 3′ sequencing primer atagggcgaattgaatttag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

AAVS1 safe-harbor targeting donor that creates a BxB1 integrase landing pad. The CAG promoter drives mCherry through an attP-GT site, enabling subsequent BxB1 integrase-mediated cassette exchange: a donor plasmid with attB-GT replaces mCherry with new cargo under the same CAG promoter. A promoter-trap SA-BSD cassette enables blasticidin selection of correctly targeted clones. Knock in via HDR.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-BxB1-LP-mCherry-BSD was a gift from Prashant Mali (Addgene plasmid # 262518 ; http://n2t.net/addgene:262518 ; RRID:Addgene_262518)

  • For your References section:

    A genome-scale CRISPRi perturbation atlas of human induced pluripotent stem cells. Nourreddine S, Doctor Y, Dailamy A, Lee YH, Hansen JN, Chinn R, Forget A, Polacco B, Muralidharan M, Sigaeva A, Sunder S, Pan E, Gao J, Chen JY, Clark T, Parker J, Obernier K, Metallo C, Ideker T, Lundberg E, Krogan N, Mali P. Nat Biotechnol. 2026 Jul 1. doi: 10.1038/s41587-026-03199-w. 10.1038/s41587-026-03199-w PubMed 42386990
Related items: