V5-RavZ
(Plasmid #262585)

• Purpose: Expresses RavZ in mammalian cells. Removes conjugated ATG8s from membranes.
• Depositing Lab: Xiaojun Tan
• Depositing Organization: University of Pittsburgh (University, School of Medicine, and Cancer Institute)
  Located in the United States of America
• Publication: Lv et al Mol Cell. 2024 Oct 17;84(20):3979-3996.e9. doi: 10.1016/j.molcel.2024.08.026. Epub 2024 Sep 19.

Backbone

• Vector backbone: pCDH
• Backbone size w/o insert (bp): 7403
• Total vector size (bp): 8954
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RavZ
• Insert Size (bp): 1545
• Entrez Gene: ravZ (a.k.a. AVR58_RS08600, AVR58_08395)
• Promoter: CMV
• Tag / Fusion Protein:
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GGCACCAAAATCAACGGGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Thomas Melia, Addgene plasmid 250878

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry