Skip to main content
Addgene
Open Menu

Alphaguide-Puro
(Plasmid #263224)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 263224 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    lentiGuide-Puro (Addgene #52963)
  • Backbone size w/o insert (bp) 10183
  • Total vector size (bp) 8323
  • Modifications to backbone
    Alpha-satellite targeting sgRNA was cloned in BsmBI sites
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human alpha-satellite
  • gRNA/shRNA sequence
    GAATCTGCAAGTGGATATTG

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang Lab (Addgene #52963)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Alphaguide-Puro was a gift from Ylli Doksani (Addgene plasmid # 263224 ; http://n2t.net/addgene:263224 ; RRID:Addgene_263224)

  • For your References section:

    Damage-induced i-loops generate eccDNA from repetitive elements. Zanella E, Giannattasio M, Bisi S, Nicassio F, Doksani Y. Mol Cell. 2026 May 21;86(10):1856-1869.e11. doi: 10.1016/j.molcel.2026.04.003. Epub 2026 Apr 30. 10.1016/j.molcel.2026.04.003 PubMed 42066753
Related items: