-
PurposeLuciferase reporter construct containing three hypoxia response elements (24-mers) from the Pgk-1 gene.
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 26731-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 26731-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL2
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHypoxia Responsive Elements (3)
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer unknown
- 3′ sequencing primer Luc_N_Rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase.
HRE: TGTCACGTCCTGCACGACTCTAGT
Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function.
DNA (Catalog # 26731-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 26731-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HRE-luciferase was a gift from Navdeep Chandel (Addgene plasmid # 26731 ; http://n2t.net/addgene:26731 ; RRID:Addgene_26731) -
For your References section:
PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a). Emerling BM, Weinberg F, Liu JL, Mak TW, Chandel NS. Proc Natl Acad Sci U S A. 2008 Feb 19. 105(7):2622-7. 10.1073/pnas.0706790105 PubMed 18268343
