Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CACNA1D (2of2) or cav1.3b_R (OZ548)
(Plasmid #28073)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28073 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Zinc finger array targeting CACNA1D (2of2) or cav1.3b
  • Alt name
    cacna1db
  • Alt name
    calcium channel, voltage-dependent, L type, alpha 1D subunit, b
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    270
  • Entrez Gene
    cacna1db (a.k.a. cav1.3b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer OK.61 GGGTAGTACGATGACGGAACCTGTC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene CACNA1D (2of2) or cav1.3b (see below). Please note that this plasmid does NOT contain the CACNA1D (2of2) or cav1.3b sequence.

Users must order the complementary plasmid CACNA1D (2of2) or cav1.3b_L (OZ547) [Addgene plasmid 28072] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).

This zinc finger array was tested for binding activity to the sequence 5'-GCGGCCGAA-3' in a bacterial two hybrid assay, and resulted in 5.30 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CACNA1D (2of2) or cav1.3b_R (OZ548) was a gift from Keith Joung (Addgene plasmid # 28073 ; http://n2t.net/addgene:28073 ; RRID:Addgene_28073)
  • For your References section:

    Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder ML, Thibodeau-Beganny S, Osiak A, Wright DA, Anthony RM, Eichtinger M, Jiang T, Foley JE, Winfrey RJ, Townsend JA, Unger-Wallace E, Sander JD, Muller-Lerch F, Fu F, Pearlberg J, Goebel C, Dassie JP, Pruett-Miller SM, Porteus MH, Sgroi DC, Iafrate AJ, Dobbs D, McCray PB, Cathomen T, Voytas DF, Joung JK. Mol Cell. 2008 Jul 25. 31(2):294-301. 10.1016/j.molcel.2008.06.016 PubMed 18657511