pSR-puro-Sec5
(Plasmid
#31117)
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSUPER.retro.puro
-
Backbone manufacturerOligoengine
- Backbone size w/o insert (bp) 6349
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec5 shRNA
-
Alt nameSEC5
-
gRNA/shRNA sequenceGGTCGGAAAGACAAGGCAGAT
-
SpeciesH. sapiens (human)
-
Entrez GeneEXOC2 (a.k.a. SEC5, SEC5L1, Sec5p)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pLXSN 5'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA Sec5 sequence:
5'-GGTCGGAAAGACAAGGCAGAT-3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR-puro-Sec5 was a gift from Christopher Counter (Addgene plasmid # 31117 ; http://n2t.net/addgene:31117 ; RRID:Addgene_31117) -
For your References section:
Sec5 and Exo84 foster oncogenic ras-mediated tumorigenesis. Issaq SH, Lim KH, Counter CM. Mol Cancer Res. 2010 Feb . 8(2):223-31. 10.1158/1541-7786.MCR-09-0189 PubMed 20145037