Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQStrep2-PREI3
(Plasmid #31592)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31592 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQStrep2
  • Backbone size w/o insert (bp) 3460
  • Modifications to backbone
    GenBank: AY028642
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    preimplantation protein 3
  • Alt name
    PSFEp758B0812
  • Alt name
    PREI3
  • Alt name
    CGI-95
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    744
  • GenBank ID
    DQ000500
  • Entrez Gene
    MOB4 (a.k.a. 2C4D, CGI-95, MOB1, MOB3, MOBKL3, PHOCN, PREI3)
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • StrepII-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQStrep2-PREI3 was a gift from Konrad Buessow (Addgene plasmid # 31592 ; http://n2t.net/addgene:31592 ; RRID:Addgene_31592)
  • For your References section:

    Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5. 4():21. 10.1186/1475-2859-4-21 PubMed 15998469