pTagRFP657-C1
(Plasmid #31872)

• Purpose: For fusion of TagRFP657 to N-term of insert. SEE DEPOSITOR COMMENTS BELOW.
• Depositing Lab: Vladislav Verkhusha
• Depositing Organization: Albert Einstein College of Medicine
  Located in United States of America
• Publication: Morozova et al Biophys J. 2010 Jul 21;99(2):L13-5.
• Citations: 2 Articles

Backbone

• Vector backbone: C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3983
• Modifications to backbone: none
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TagRFP657
• Insert Size (bp): 735
• Mutation: M44Q, K69H, F84W, S148H, S165T, D166A, M167L, L181F, and R203Y compared to mKate (but numbering is relative to common EGFP); SEE DEPOSITOR COMMENTS BELOW

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: ggtaggcgtgtacggtgggag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is an additional E10D amino acid change in Addgene's quality control sequence, the full plasmid sequence is assembled and may contain slight discrepancies. According to Dr. Verkhusha, this mutation should not change any properties of the TagRFP657 protein.

**NOTE**: Addgene NGS results indicate that the TagRFP657 ORF is duplicated. In order to remove the duplicated ORF and restore the MCS, recipient scientists can cut with BglII, gel purify the large band, and re-ligate the vector. Alternatively, BglII can be used as the 5' restriction site for cloning, with the 3' site being located in the MCS.

DNA (Catalog # 31872-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 31872-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.