-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 32610-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 32610-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4700
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTcf/Lef:H2B-GFP
- Promoter hsp68
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AseI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GF PGenotFW: A CAACAAGCGCTCGACCATCAC;
- 3′ sequencing primer GFPGenotRW: AGTCGATGCCCTTCAGCTCGAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To g ene r a t e t h e p T CF /L e f :H 2 B -GFP co n s t ru c t , s i x
copies of the TCF/Lef response elements together with
the hsp68 minimal promoter from the TCF/Lef-LacZ
reporter construct [11] were inserted into the AseI/Nhe1
sites of pCMV::H2B-GFP.
DNA (Catalog # 32610-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 32610-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tcf/Lef:H2B-GFP was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 32610 ; http://n2t.net/addgene:32610 ; RRID:Addgene_32610) -
For your References section:
A sensitive and bright single-cell resolution live imaging reporter of Wnt/ss-catenin signaling in the mouse. Ferrer-Vaquer A, Piliszek A, Tian G, Aho RJ, Dufort D, Hadjantonakis AK. BMC Dev Biol. 2010 Dec 21;10:121. 10.1186/1471-213X-10-121 PubMed 21176145