-
PurposeFor visualization of ATF6 in mammalian cells with a mutation in ATF6 that blocks cleavage by protease S1P. Activated protein will remain in the Golgi.
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 32956-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 32956-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATF6
-
SpeciesH. sapiens (human)
-
MutationS1Protease site mutation: R415A/R416A
-
Entrez GeneATF6 (a.k.a. ACHM7, ATF6A, ATP6alpha)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer hATF6-R (gaacccatcctcgaagttca)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
During sequencing a change of Methionine 67 to Leucine, and Methionine 313 to Isoleucine was detected. This change in the basic region should not affect experiments with this construct, but could affect DNA binding by derivatives made from this plasmid.
DNA (Catalog # 32956-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 32956-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-ATF6-(S1P-) was a gift from Ron Prywes (Addgene plasmid # 32956 ; http://n2t.net/addgene:32956 ; RRID:Addgene_32956) -
For your References section:
The luminal domain of ATF6 senses endoplasmic reticulum (ER) stress and causes translocation of ATF6 from the ER to the Golgi. Chen X, Shen J, Prywes R. J Biol Chem. 2002 Apr 12. 277(15):13045-52. 10.1074/jbc.M110636200 PubMed 11821395