Skip to main content
Addgene
Open Menu

nGCaMP2-NpuDnaEn
(Plasmid #34850)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34850 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 34850-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 34850-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pTriEx-3
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nGCaMP2-NpuDnaEn
  • Species
    Nostoc punctiforme
  • Insert Size (bp)
    777
  • Promoter CMV, T7 lac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer (TriEx UP) GTTATTGTGCTGTCTCATCA
  • 3′ sequencing primer T7 terminal
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NpuDnaEn was cloned from Addgene plasmid 12172.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nGCaMP2-NpuDnaEn was a gift from Kevin Truong (Addgene plasmid # 34850 ; http://n2t.net/addgene:34850 ; RRID:Addgene_34850)

  • For your References section:

    Split-intein mediated re-assembly of genetically encoded Ca(2+) indicators. Wong SS, Kotera I, Mills E, Suzuki H, Truong K. Cell Calcium. 2011 Nov 29. 10.1016/j.ceca.2011.10.006 PubMed 22133610
Related items:
Commonly requested with: