NpuDnaEc-cGCaMP2
(Plasmid
#34851)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTriEx-3
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNpuDnaEc-cGCaMP2
-
SpeciesNostoc punctiforme
-
Insert Size (bp)1014
- Promoter CMV, T7 lac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer (TriEx UP) GTTATTGTGCTGTCTCATCA
- 3′ sequencing primer T7 terminal (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NpuDnaEc-cGCaMP2 was a gift from Kevin Truong (Addgene plasmid # 34851 ; http://n2t.net/addgene:34851 ; RRID:Addgene_34851) -
For your References section:
Split-intein mediated re-assembly of genetically encoded Ca(2+) indicators. Wong SS, Kotera I, Mills E, Suzuki H, Truong K. Cell Calcium. 2011 Nov 29. 10.1016/j.ceca.2011.10.006 PubMed 22133610