pMXs-puro GFP-b5 ER
(Plasmid #38274)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al Autophagy. 2010 Aug;6(6):764-76.

Backbone

• Vector backbone: pMXs-puro
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 6878
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cytochrome b5
• Alt name: Cyb5a
• Species: R. norvegicus (rat)
• Insert Size (bp): 123
• Mutation: Cyb5a Tranmembrane region from 95 to 134 amino acids residues
• GenBank ID: AF007107
• Entrez Gene: Cyb5a (a.k.a. Cyb5)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: AAAATTAGTCAGCCATGGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A cDNA of rat cytochrome b5 provided by K. Mihara, Kyushu University, Fukuoka, Japan
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry