pGEX4T-1 hSlp2-a del.C2AB
(Plasmid #40059)

• Depositing Lab: Fernando Martin-Belmonte
• Publication: Galvez-Santisteban et al Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541.

Backbone

• Vector backbone: pGEX4T-1
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 6700
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Expression in BL21 with IPTG
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hSlp2-a del.C2AB
• Alt name: Synaptotagmin-like protein 2-a
• Alt name: Slp2-a del.C2AB
• Alt name: Exophilin4
• Species: H. sapiens (human)
• Insert Size (bp): 1817
• Mutation: deletion of C2A and C2B domains (601-910)
• GenBank ID: NM_032943.3
• Entrez Gene: SYTL2 (a.k.a. CHR11SYT, EXO4, PPP1R151, SGA72M, SLP2, SLP2A)
• Promoter: Tac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is a known amino acid insertion (Q) at ~aa147 that does not affect the plasmid function.