Skip to main content

pHes1(467)-luc
(Plasmid #41723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41723 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 41723-D50 50 μg of DNA in Tris buffer $495
DNA 41723-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL2-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5597
  • Total vector size (bp) 6110
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hes1 Promoter (-467 to +46)
  • Alt name
    Hes1
  • Alt name
    hairy and enhancer of split 1 Promoter (-467 to +46)
  • Alt name
    hairy and enhancer of split 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    513
  • Mutation
    Contains the murine Hes1 promoter (-467 to +46)
  • GenBank ID
    NC_000082.6
  • Entrez Gene
    Hes1 (a.k.a. Hry, bHLHb39)
  • Promoter Hes1 promoter fragment (-467 to +46)
  • Tag / Fusion Protein
    • Firefly luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: Hes1-Luc

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHes1(467)-luc was a gift from Ryoichiro Kageyama & Raphael Kopan (Addgene plasmid # 41723 ; http://n2t.net/addgene:41723 ; RRID:Addgene_41723)
  • For your References section:

    Structure, chromosomal locus, and promoter of mouse Hes2 gene, a homologue of Drosophila hairy and Enhancer of split. Nishimura M, Isaka F, Ishibashi M, Tomita K, Tsuda H, Nakanishi S, Kageyama R. Genomics. 1998 Apr 1;49(1):69-75. 10.1006/geno.1998.5213 PubMed 9570950