-
PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineering
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 41822-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 41822-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA_DNMT3a-T2
-
SpeciesH. sapiens (human)
-
Entrez GeneDNMT3A (a.k.a. DNMT3A-3, DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer T7
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GAGATGATCGCCCCTTCTTC
DNA (Catalog # 41822-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 41822-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA_DNMT3a-T2 was a gift from George Church (Addgene plasmid # 41822 ; http://n2t.net/addgene:41822 ; RRID:Addgene_41822) -
For your References section:
RNA-Guided Human Genome Engineering via Cas9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM. Science. 2013 Feb 15;339(6121):823-6. doi: 10.1126/science.1232033 10.1126/science.1232033 PubMed 23287722