Skip to main content

pCXB-EBNA1
(Plasmid #41857)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41857 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 41857-D50 50 μg of DNA in Tris buffer $495
DNA 41857-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCXB
  • Backbone size w/o insert (bp) 4452
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EBNA-1
  • Alt name
    HHV4-EBNA-1.1
  • Species
    human herpesvirus 4
  • Insert Size (bp)
    1926
  • GenBank ID
    AJ507799
  • Entrez Gene
    EBNA-1 (a.k.a. HHV4_EBNA-1.2)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCAG-F
  • 3′ sequencing primer TTAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    EBNA-1 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCXB-EBNA1 was a gift from Shinya Yamanaka (Addgene plasmid # 41857 ; http://n2t.net/addgene:41857 ; RRID:Addgene_41857)
  • For your References section:

    An Efficient Non-viral Method to Generate Integration-Free Human iPS Cells from Cord Blood and Peripheral Blood Cells. Okita K, Yamakawa T, Matsumura Y, Sato Y, Amano N, Watanabe A, Goshima N, Yamanaka S. Stem Cells. 2012 Nov 29. doi: 10.1002/stem.1293. 10.1002/stem.1293 PubMed 23193063