Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCE-mp53DD
(Plasmid #41856)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41856 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Trp53
  • Alt name
    p53
  • Alt name
    Tp53
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    334
  • Mutation
    Δ40-903
  • GenBank ID
    NM_011640
  • Entrez Gene
    Trp53 (a.k.a. Tp53, bbl, bfy, bhy, p44, p53)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCAG-F
  • 3′ sequencing primer TTAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    pCEP4 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCE-mp53DD was a gift from Shinya Yamanaka (Addgene plasmid # 41856 ; http://n2t.net/addgene:41856 ; RRID:Addgene_41856)
  • For your References section:

    An Efficient Non-viral Method to Generate Integration-Free Human iPS Cells from Cord Blood and Peripheral Blood Cells. Okita K, Yamakawa T, Matsumura Y, Sato Y, Amano N, Watanabe A, Goshima N, Yamanaka S. Stem Cells. 2012 Nov 29. doi: 10.1002/stem.1293. 10.1002/stem.1293 PubMed 23193063