Skip to main content
Addgene
Open Menu

pcDNA3-GFP-IMP2-2_antisense-control
(Plasmid #42174)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42174 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 42174-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 42174-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1/CT-GFP TOPO
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 6157
  • Total vector size (bp) 7828
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Insulin-like growth factor 2 mRNA binding protein 2-2 antisense control
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1671
  • GenBank ID
    NM_001007225.1
  • Entrez Gene
    IGF2BP2 (a.k.a. IMP-2, IMP2, VICKZ2)
  • Promoter T7
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTAAGCTTTCCGTATGTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-GFP-IMP2-2_antisense-control was a gift from Alexandra Kiemer (Addgene plasmid # 42174 ; http://n2t.net/addgene:42174 ; RRID:Addgene_42174)

  • For your References section:

    IGF2 mRNA binding protein p62/IMP2-2 in hepatocellular carcinoma: antiapoptotic action is independent of IGF2/PI3K signaling. Kessler SM, Pokorny J, Zimmer V, Laggai S, Lammert F, Bohle RM, Kiemer AK. Am J Physiol Gastrointest Liver Physiol. 2013 Feb 15;304(4):G328-36. doi: 10.1152/ajpgi.00005.2012. Epub 2012 Dec 20. 10.1152/ajpgi.00005.2012 PubMed 23257922
Related items:
Commonly requested with: