Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #42175)


Item Catalog # Description Quantity Price (USD)
Plasmid 42175 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pcDNA3.1/CT-GFP TOPO
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6157
  • Total vector size (bp) 7828
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Insulin-like growth factor 2 mRNA binding protein 2-2
  • Alt name
    IMP2-2, p62, IGF2BP2-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    IGF2BP2 (a.k.a. IMP-2, IMP2, VICKZ2)
  • Promoter T7
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTAAGCTTTCCGTATGTAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-GFP-IMP2-2 was a gift from Alexandra Kiemer (Addgene plasmid # 42175 ; ; RRID:Addgene_42175)
  • For your References section:

    IGF2 mRNA binding protein p62/IMP2-2 in hepatocellular carcinoma: antiapoptotic action is independent of IGF2/PI3K signaling. Kessler SM, Pokorny J, Zimmer V, Laggai S, Lammert F, Bohle RM, Kiemer AK. Am J Physiol Gastrointest Liver Physiol. 2013 Feb 15;304(4):G328-36. doi: 10.1152/ajpgi.00005.2012. Epub 2012 Dec 20. 10.1152/ajpgi.00005.2012 PubMed 23257922