pECFP(C1)-NIPP1/RKTK
(Plasmid
#44227)
-
Depositing Labs
-
Depositing OrganizationUniversity of Dundee
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 44227-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 44227-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5330
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNIPP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)630
-
MutationV201K and F203K
-
GenBank IDNM_014110
-
Entrez GenePPP1R8 (a.k.a. ARD-1, ARD1, NIPP-1, NIPP1, PRO2047)
- Promoter CMV
-
Tag
/ Fusion Protein
- CFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer TGGTCCTGCTGGAGTTCGTGACC
- 3′ sequencing primer GTTTGGACAAACCACAACTAGAATGCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 44227-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 44227-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECFP(C1)-NIPP1/RKTK was a gift from Angus Lamond & Laura Trinkle-Mulcahy (Addgene plasmid # 44227 ; http://n2t.net/addgene:44227 ; RRID:Addgene_44227) -
For your References section:
Dynamic targeting of protein phosphatase 1 within the nuclei of living mammalian cells. Trinkle-Mulcahy L, Sleeman JE, Lamond AI. J Cell Sci. 2001 Dec;114(Pt 23):4219-28. PubMed 11739654