Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pECFP(C1)-NIPP1
(Plasmid #44226)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44226 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pECFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5330
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NIPP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    630
  • GenBank ID
    NM_014110
  • Entrez Gene
    PPP1R8 (a.k.a. ARD-1, ARD1, NIPP-1, NIPP1, PRO2047)
  • Promoter CMV
  • Tag / Fusion Protein
    • CFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer TGGTCCTGCTGGAGTTCGTGACC
  • 3′ sequencing primer GTTTGGACAAACCACAACTAGAATGCAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECFP(C1)-NIPP1 was a gift from Angus Lamond & Laura Trinkle-Mulcahy (Addgene plasmid # 44226 ; http://n2t.net/addgene:44226 ; RRID:Addgene_44226)
  • For your References section:

    Dynamic targeting of protein phosphatase 1 within the nuclei of living mammalian cells. Trinkle-Mulcahy L, Sleeman JE, Lamond AI. J Cell Sci. 2001 Dec;114(Pt 23):4219-28. PubMed 11739654