Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

K15-EGFP
(Plasmid #44266)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44266 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4737
  • Total vector size (bp) 9872
  • Modifications to backbone
    CMV promoter replaced with murine K15 promoter (-4.8) fragment
  • Vector type
    Mammalian Expression, Mouse Targeting ; Fluorescence microscopy
  • Selectable markers
    Neomycin (select with G418) ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    K15 promoter (-4.8)
  • Alt name
    Krt1-15 promoter
  • Alt name
    mouse keratin 15 promoter
  • Alt name
    Krt15 keratin 15
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4961
  • Mutation
    Contains the murine K15 promoter (-4.8) fragment
  • GenBank ID
    NC_000077.6 AF542050
  • Entrez Gene
    Krt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
  • Promoter murine K15 promoter (-4.8) fragment
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pBR322ori-F
  • 3′ sequencing primer EGFP-N; SV40-pA-R
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Alternate plasmid name: pEGFP-N2 K15

The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were

CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),

respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2

The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K15-EGFP was a gift from George Cotsarelis (Addgene plasmid # 44266 ; http://n2t.net/addgene:44266 ; RRID:Addgene_44266)
  • For your References section:

    Capturing and profiling adult hair follicle stem cells. Morris RJ, Liu Y, Marles L, Yang Z, Trempus C, Li S, Lin JS, Sawicki JA, Cotsarelis G. Nat Biotechnol. 2004 Apr;22(4):411-7. Epub 2004 Mar 14. 10.1038/nbt950 PubMed 15024388