Skip to main content
Addgene
Open Menu

pCI-EGFP-NR2a wt
(Plasmid #45445)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45445 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 45445-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 45445-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4006
  • Total vector size (bp) 10031
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NR2A
  • Alt name
    NMDAR2A
  • Alt name
    GRIN2a
  • Alt name
    GluN2a
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    6000
  • Mutation
    EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 21)
  • GenBank ID
    D13211.1 BAA02498.1
  • Entrez Gene
    Grin2a (a.k.a. GluN2A, NMDAR2A, NR2A)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site SalI (destroyed during cloning)
  • 5′ sequencing primer T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-EGFP-NR2a wt was a gift from Andres Barria & Robert Malinow (Addgene plasmid # 45445 ; http://n2t.net/addgene:45445 ; RRID:Addgene_45445)

  • For your References section:

    Subunit-specific NMDA receptor trafficking to synapses. Barria A, Malinow R. Neuron. 2002 Jul 18;35(2):345-53. 10.1016/S0896-6273(02)00776-6 PubMed 12160751
Related items:
Commonly requested with: