Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCI-EGFP-NR1 wt
(Plasmid #45446)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45446 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4006
  • Total vector size (bp) 8996
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NR1
  • Alt name
    NMDAR1
  • Alt name
    Grin1
  • Alt name
    GluN1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    5000
  • Mutation
    EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 26)
  • GenBank ID
  • Entrez Gene
    Grin1 (a.k.a. GluN1, NMDAR1, NR1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-EGFP-NR1 wt was a gift from Andres Barria & Robert Malinow (Addgene plasmid # 45446 ; http://n2t.net/addgene:45446 ; RRID:Addgene_45446)
  • For your References section:

    Subunit-specific NMDA receptor trafficking to synapses. Barria A, Malinow R. Neuron. 2002 Jul 18;35(2):345-53. 10.1016/S0896-6273(02)00776-6 PubMed 12160751

Ready-to-use affinity reagents

Looking for affinity reagents related to this plasmid? Check out this option:

Learn More