-
Depositing Lab
-
Depositing OrganizationUniversidad de Valladolid
Located in Spain -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 45539-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 45539-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 6230
-
Vector typeMammalian Expression
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemit-2mutAEQ
-
Alt nameMitochondrially targeted 28,119-double mutated Aequorin
-
Speciesjellyfish
-
Insert Size (bp)950
-
MutationAsp119Ala and Asn28Leu
-
Tag
/ Fusion Protein
- Mitochondrially targeted (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAATTCGGCTACGGCTGACCGTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A.
DNA (Catalog # 45539-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 45539-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+/mit-2mutAEQ was a gift from Javier Alvarez-Martin (Addgene plasmid # 45539 ; http://n2t.net/addgene:45539 ; RRID:Addgene_45539) -
For your References section:
Mitochondrial free [Ca(2+)] dynamics measured with a novel low-Ca(2+) affinity aequorin probe. de la Fuente S, Fonteriz RI, de la Cruz PJ, Montero M, Alvarez J. Biochem J. 2012 Aug 1;445(3):371-6. doi: 10.1042/BJ20120423. 10.1042/BJ20120423 PubMed 22671130
Map uploaded by the depositor.
