-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 8700
-
Vector typeMammalian Expression
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameER-2mutAEQ
-
Alt nameER targeted 28,119-double mutated Aequorin
-
Speciesjellyfish
-
Insert Size (bp)3300
-
MutationAsp119Ala and Asn28Leu
-
Tag
/ Fusion Protein
- ER targeted (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCCACTAGTCCAGTGTGGTGGAATTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 2600bp ER-targeting sequence is unknown and represented by a series of G in the sequence of the plasmid.
Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+/ER-2mutAEQ was a gift from Javier Alvarez-Martin (Addgene plasmid # 45541 ; http://n2t.net/addgene:45541 ; RRID:Addgene_45541) -
For your References section:
Mitochondrial free [Ca(2+)] dynamics measured with a novel low-Ca(2+) affinity aequorin probe. de la Fuente S, Fonteriz RI, de la Cruz PJ, Montero M, Alvarez J. Biochem J. 2012 Aug 1;445(3):371-6. doi: 10.1042/BJ20120423. 10.1042/BJ20120423 PubMed 22671130