Skip to main content

EHD2-mEGFP
(Plasmid #45932)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45932 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 45932-D50 50 μg of DNA in Tris buffer $495
DNA 45932-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmEGFP-N-DEST
  • Backbone manufacturer
    Clontech/ custom-made
  • Backbone size w/o insert (bp) 4745
  • Total vector size (bp) 6374
  • Modifications to backbone
    pmEGFP-N-DEST was created by the ligation of the Gateway cassette as HindIII/AgeI fragment into pmEGFP-N1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Eps-15 homology domain-containing protein2
  • Alt name
    EHD2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1629
  • GenBank ID
    NM_014601.3
  • Entrez Gene
    EHD2 (a.k.a. PAST2)
  • Promoter CMV
  • Tag / Fusion Protein
    • monomeric EGFP_FrameN1 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gttttcccagtcacgacgttgtaaaacgacggccagt
  • 3′ sequencing primer ccctatagtgagtcgtattacatggtcatagctgtttcctgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EHD2-mEGFP was a gift from Ari Helenius (Addgene plasmid # 45932 ; http://n2t.net/addgene:45932 ; RRID:Addgene_45932)
  • For your References section:

    Oligomers of the ATPase EHD2 confine caveolae to the plasma membrane through association with actin. Stoeber M, Stoeck IK, Hanni C, Bleck CK, Balistreri G, Helenius A. EMBO J. 2012 May 16;31(10):2350-64. doi: 10.1038/emboj.2012.98. Epub 2012 Apr 13. 10.1038/emboj.2012.98 PubMed 22505029